Cellular and Molecular Biology Topics
The
Genetic Code
The genetic code is the correspondence between nucleotide triplets and amino acids in proteins. A codon is the basic unit of the genetic code. Each of the 64 possible nucleotide triplets code for one amino acid or a stop sequence. 61 codons code for 20 amino acids, and many amino acids have more than one codon. The start codon AUG also codes for Met (all primary transcripts start with Met). Three codons do not code for amino acids but are termination signals: UAA, UGA and UAG.
In some cases, the last nucleotide of a triplet can be changed without changing the amino acid it codes for. This is known as degeneracy. Because there are 20 amino acids and 61 triplets that code for them, it is evident that the code is highly degenerated. Only Met and Trp are coded by just one codon. The number of codons that code for a particular amino acid correlates with the frequency of the amino acid in proteins, i.e. more abundant amino acids have more codons while rare codons are generally used in proteins with low expression.
An open reading frame ORF is the DNA nucleotide sequence that encodes for a given polypeptides, including signals for an initial Met and the final stop codon. An ORF will have only one possible amino acid sequence:
AUGAGUAGAGAAUGUCCGGUUAAGCUAUAA
Met Ser Arg Glu Cys Pro
Val Lys Leu Stop
An amino acid sequence can be back-translated into more than one ORF:
Leu Ile
Met Lys Arg Glu
Asp Glu
UUAAUUAUGAAACGUGAAGAUGAA
UUGAUCAUGAAGCGCGAGGACGAG
An mRNA can potentially be translated in three different reading frames, each encoding a different polypeptide. But the start codon will dictate which is the correct reading frame. Typically only one ORF is translated.
Codons and their respective amino acids or stop signals are nearly universal in both prokaryotes and eukaryotes, with few exceptions. A few systems, like mammalian mitochondria, yeast, and protozoa have some exceptions. Human mitochondria reads UGA as Trp rather than a stop codon, AGA and AGG are read as stop rather than Arg, and AUA is read as Met rather than Ile. The pathogenic yeast Candida albicanis reads CUG as Ser instead of Leu. Ciliated protozoa read the stop codons UAA and UGA as Glu.
Since more than one codon exists for most amino aids, there is a possibility of variation from species to species regarding the usage of each codon more or less frequently (codon bias). Selenocysteine-containing proteins are found in all organisms (ex. glutathione peroxidase). Synthesis of these proteins involve a special tRNA linked to SeCys that recognizes a UGA codon distinguished by the translational apparatus by unique sequence structures flanking the codon.
Take Quiz: [Q1] [Q2] [Q3]
Back to Basics:
Transfer RNA
Transfer RNAs (tRNAs) are
single chains containing 73-93 ribonucleotides, arranged in a cloverleaf pattern.
They contain many unusual bases (7-15 per molecule). Some are methylated or
demethylated derivatives of the common bases formed by enzymatic modification
of the precursor RNA. Methylation prevents the formation of certain base pairs,
rendering some bases accesible to other interactions.
The 5 end of tRNA is phosphorylated, and its terminal residue is usually phosphoguanine. The 3 end has the sequence CCA. The activated amino acid is attached to the 3 hydroxyl of the terminal adenosine.
About half the nucleotides are base-paired to form double helices. Five groups of bases are not paired: 3 CCA terminus, the TYC loop, extra arm (contains a variable number of residues), DHU loop and anticodon loop.
The anticodon loop consists of seven bases with the following sequence (were XYZ is the coding triplet):
5 pyrimidine pyrimidine XYZ - modified purine- variable base
tRNA serves as the adaptor molecule that recognizes both the enzyme that attaches the correct amino acid and the codon on mRNA. The anticodon on the tRNA is the recognition site for the mRNA codon, and that recognition occurs by base pairing.
Some tRNA molecules can recognize more than one codon. Usually the first two bases of the codon are the same, while the third varies. The steric criteria for pairing of the third base (5 position) might be less stringent than for the first two. This is known as steric freedom or wobble. U at the wobble position of the anticodon may pair with either purine in the codon, G will pair with either pyrimidine. The unusual base inosine (I) is often found at the 5 position of the anticodon and can pair bond with either A, C or U.
Aminoacyl-tRNA synthetases catalyzes the charging of tRNAs by a two step reaction:
amino acid + ATP 
aminoacyl-adenylate + PPi
aminoacyl-adenylate
+ tRNA
aminoacyl-tRNA + AMP
Net reaction:
amino acid
+ ATP + tRNA
aminoacyl-tRNAs + AMP + PPi
Aminoacyl-tRNA synthetases are specific for each amino acid, examples: valyl tRNA synthetase, alanyl tRNA synthetase, glycyl tRNA synthetase, etc. They recognize specific nucleotides at the codon, DHU loop and/or a microhelix at the 3 acceptor stem.
A double-sieve mechanism insures proper charging of tRNAs based on recognition of the amino acid by two different sites in the enzyme: a charging site and a hydrolytic site. For example, isoleucyl tRNA synthetase may bind valine at its charging site because it is similar to Ile. But the tRNA promotes the hydrolysis of valine adenylate by moving it into the hydrolytic site. This preventing its erroneous incorporation into the protein. It is believed that the hydrolytic site is just large enough to accommodate Val-AMP but too small to allow entry of Ile-AMP.
Take Quiz: [Q1] [Q2] [Q3]
Back to Basics:
Ribosomes
Ribosomal RNA (rRNA) is transcribed from a single operon and later cleaved and arranged into an intricate secondary structure important in the assembly of the ribosome. A prokaryotic ribosome contains both (rRNA) and proteins. It is usually referred to by its sedimentation coefficient of 70s and has two subunits: large 50s and small 30s, which associate together during the initiation step of translation. The 50s subunit contains 23s and 5s rRNAs and the proteins L1, L2 and L3. The 30s subunit contains 16s rRNA and the proteins S1, S2 and S3. A polysome is a complex of one mRNA being translated simultaneously by several ribosomes.
Eukaryotes have an 80s ribosome that contains a large 60s subunit and a small 40s subunit. The large subunit has a 28s and 5s rRNAs counterparts to the prokaryotic 23s and 5s, as well as an additional 5.8s rRNA. The small subunit contains an 18s rRNA homologous to the prokaryotic 16s.
The assembled ribosome has three site were tRNAs interact: A, P and E. The A (aminoacyl acceptor) site binds an incoming aminoacyl-tRNA that recognizes the codon in the A site. The direction of translation is 5 to 3, allowing the mRNA to be translated at the same time it is transcribed (both in the same direction). The polypeptide grows from N-terminus to C-terminus.
After the first t-RNA has move into the P site, a new amino acyl-tRNA enters the A site.
The elongating peptide chain in the P (peptidyl) site is transferred to the amino group of the incoming amino-acyl tRNA.
This process involves the amino group of the aminoacyl-tRNA in the A site nucleophilic displacement of the tRNA of the peptidyl tRNA in the P site, thereby transferring the nascent polypeptide to the A site tRNA. The reaction is catalyzed by peptidyl transferase activity of the 50s subunit.
After formation of the peptide bond, the newly deacylated P-site tRNA is released and replaced by the newly formed peptidyl t-RNA from the A site. An additional E (exit) site transiently binds the outgoing uncharged tRNA.
Translation is carried out in three steps: initiation, elongation and termination.
Take Quiz: [Q1] [Q2] [Q3]
Back to Basics: Biochemistry
Translation Initiation
Initiation involves the ribosomal subunits, associated initiation factors and initiator mRNA. It is during this step that ribosomes select the initiation codon in the mRNA.
Two interactions determine the site for initiation of translation in prokaryotes: (1) pairing of the Ribosomal Binding Sequence (RBS) with the 3 end of the 16s rRNA, and (2) pairing of the anticodon of the fMet initiator tRNAf with the mRNA start codon. The RBS or Shine-Delgarno sequence is centered about 10 bases upstream of the start codon (AUG) in prokaryotes. fMet is an N-formylated modification of Met attached to a special initiator Met tRNAf.
Prokaryotic initiation involves the assembly of the two ribosomal subunits and fMet-tRNAf onto the appropriate start codon by the protein initiator factors IF1, IF2 and IF3. Following termination of translation, the complete 70s ribosome is released, and while it stays complete it will be inactive. Activation requires dissociation into the 30s and 50s subunits. The role of the initiation factors is to dissociate the inactive 70s ribosome into the active 30s and 50s subunits. This dissociation is mediated by IF1 and IF3. A 30s-IF1-IF3 complex is formed, which is unable to reasociate with 50s.
To start the initiation process, IF2 complexes with GTP and fMet-tRNAf, which then binds the 30s subunit. Now 30s can bind mRNA at the RBS, resulting in a 30s initiation complex. This initiation complex includes placement of the initiator tRNA into their P site. The mRNA is bound to the 30s subunit through complementary interaction between the RBS with the 16s ribosomal subunit.
The next step is the joining of the 50s with the 30s initiation complex, resulting in the 70s initiation complex. During the joining reaction, the GTP is hydrolyzed by IF2 into GDP and released. At this point all initiation factors are released, and the fMet-tRNAf is active for peptide bond formation.
Eukaryotic initiation does not involve an RBS sequence and the initiation amino acid is Met rather than fMet. A complex containing eIF2, GTP and Met-tRNA associates with the 40s ribosomal unit. This pre-initiation complex binds to the 5- end cap of mRNA. The cap is a 7-methyl guanylate that is post-transcriptionally attached by a triphosphate linkage to the first nucleotide of the mRNA (usually an A or G). A cap binding protein (eIF4F) binds to the cap and helps association of the pre-initiation complex to mRNA. After it binds to the cap, the 40s complex scans the mRNA from its 5 end until it recognizes the first AUG codon in a correct context. The eIF2 protein is important for recognition of the initiation codon. Upon bonding to the start codon, 60s joins with the 40s initiation complex, GDP is hydrolyzed and released, eIF2 is released, and Met tRNA is in the P site. eIF2B restores the GTP in IF2.
Take Quiz: [Q1] [Q2] [Q3]
Advance Topics:
Elongation of the Polypeptide
Elongation factor Tu bound to GTP (EFTu-GTP in prokaryotes or EF1A-GTP in eukaryotes) associates with aminoacyl-tRNA. This complex fits into a vacant A site.
If the anticodon of the tRNA matches the codon, the complex stabilizes and GTP is hydrolyzed, resulting in the release of EFTu-GDP ( EF1A-GDP in eukaryotes). EFTs catalyzes the exchange of GTP for GDP in EFTu-GDP. The peptide chain is transferred from tRNA in the P site to aminoacyl-tRNA in the A site. Peptidyl transferase catalyzes the formation of the peptide bond.
EFG drives translocation of peptidyl-tRNA from A to P site, concomitant with the movement of the mRNA relative to the ribosome by one codon. The deacylated tRNA moves to the E site and is discharged. The next codon to be read is now in the A site. EFG bound to GTP associates with the 50s ribosomal subunit, stimulating GTP hydrolysis and conformational change in EFG (GTPase switch). The conformational change drives the stem of EFG into the A site, moving the tRNAs and mRNA by a distance corresponding to one codon.
The translocation processes is driven by hydrolysis of GTP bound to EFG. After translocation, EFG-GDP is released from the ribosome and another cycle of elongation can ensue. The elongating polypeptide is always coupled to a ribosome bound to tRNA and thus cannot be prematurely discharged from the translation apparatus.
Molecular mimicry is evident in how EFG mimics the shape of tRNA. Its structure is remarkably similar to the EFTu-tRNA complex. The amino terminus of EFG is homologous to EFTu, and the carboxy terminus comprises a protein domain that mimics the form of tRNA.
The structural similarity suggests the following form of action for EFG. In the presence of GTP, EFG binds to the ribosome primarily through interaction of its EFTu homologous region with the 50s ribosomal unit. With GTP hydrolysis, EFG undergoes a conformational change that forces the initiation factor into the A site of the 30s ribosomal subunit, leading to the displacement of the peptidyl-tRNA into the P site. The movement of the peptidyl tRNA carries with it the mRNA and the deacylated tRNA.
The A fragment of the toxin catalyzes the covalent attachment of the adenosine diphosphate ribose unit of NAD+ to the nitrogen atom of the diphthamide ring of EF2. Diphthamide is an unusual amino acid residue in EF2 formed by posttranslational modification of histidine. The ADP-ribosilation of EF2 blocks its ability to carry out the translocation of the growing polypeptide chain, blocking protein synthesis of targeted cells.
Take Quiz: [Q1] [Q2] [Q3]
Advance Topics: Molecular Biology Lab
Transcription Termination, Inhibition and Regulation
Three prokaryotic factors designated release factors (RF) 1, RF2 and RF3 function in the termination of protein synthesis. When the A site is on a termination codon, it is recognized by RF1 (UAA or UAG) or RF2 (UAA or UGA). RF3-GTP assists RF1 or RF2.
The binding of these factors at the A site alter peptidyl transferase, causing it to hydrolyze the ester of the peptidyl-tRNA. After the peptide is released, the dissociation of the ribosome from the mRNA requires hydrolysis of the GTP.
Two release factors, eRF1 and eRF3, participate in eukaryotic termination. ERF1 is thought to function analogously to RF1 and RF2, and eRF3 associates with GTP and carries out a similar function to RF3.
Take Quiz: [Q1] [Q2] [Q3]
Continue
to "Protein Synthesis II" or take a
test: [T1] [T2] [T3].
Need more practice? Answer the following review questions:
Questions not yet available